Jump to ContentJump to Main Navigation
Imagery in the 21st Century$

Oliver Grau

Print publication date: 2011

Print ISBN-13: 9780262015721

Published to MIT Press Scholarship Online: August 2013

DOI: 10.7551/mitpress/9780262015721.001.0001

Show Summary Details
Page of

PRINTED FROM MIT PRESS SCHOLARSHIP ONLINE (www.mitpress.universitypressscholarship.com). (c) Copyright The MIT Press, 2018. All Rights Reserved. An individual user may print out a PDF of a single chapter of a monograph in MITSO for personal use. Subscriber: null; date: 24 October 2019

Bio Art: From Genesis to Natural History of the Enigma

Bio Art: From Genesis to Natural History of the Enigma

Chapter:
(p.57) 4 Bio Art: From Genesis to Natural History of the Enigma
Source:
Imagery in the 21st Century
Author(s):

Eduardo Kac

Publisher:
The MIT Press
DOI:10.7551/mitpress/9780262015721.003.0004

Abstract and Keywords

This chapter focuses on the efforts of the author of bio art and transgenic art; he compares the advancements of biotechnology with the popularization of computers. It further discusses the author’s important transgenic artworks and briefly explains the evolution of bio art. Genesis, GFP Bunny, The Eighth Day, Move 36, and Specimen of Secrecy about Marvelous Discoveries are the various artworks among the author’s discussion in the field of genetic engineering technology. The relationship between the above-mentioned biotopes and artistic works cover the later parts of the chapter, which concludes with an analysis of The Human Genome Project and Natural History of the Enigma concepts.

Keywords:   bio art, transgenic artworks, biotechnology, genetic engineering technology, Human Genome Project

For almost two decades my work has explored the boundaries between humans, animals, and robots.1 Thus, transgenic art can be seen as a natural development of my previous work. In my telepresence art, developed since 1986, humans coexist with other humans and nonhuman animals through telerobotic bodies. In my biotelematic art, developed since 1994, biology and networking are no longer co-present but coupled so as to produce a hybrid of the living and the telematic. With transgenic art, developed since 1998, the animate and the technological can no longer be distinguished. The implications of this ongoing work have particular social ramifications, crossing several disciplines and providing material for further reflection and dialogue.

The presence of biotechnology will increasingly change from one found mainly in agricultural and pharmaceutical practices to a larger role in popular culture, just as the perception of the computer changed historically from an industrial device and military weapon to a tool of communication, entertainment, and education. Terms formerly perceived as “technical,” such as megabytes and ram, for example, have entered the vernacular. Likewise, technical jargon that may seem out of place in ordinary discourse, such as marker and protein, will simply be incorporated into the larger verbal landscape of everyday language. This is made clear by the fact that high school students in the United States already create transgenic bacteria routinely in school labs, using affordable kits. The popularization of technical discourse inevitably risks the dissemination of a reductive and instrumental ideological view of the world. Without ever relinquishing its right to formal experimentation and subjective inventiveness, art can—art should—contribute to the development of alternative views of the world that resist dominant ideologies. In my work I subvert contemporary technologies—not to make detached comments on social change, but to enact critical views, to make present in the physical world invented new entities (artworks that include transgenic organisms) that seek to open a new space for both emotional and intellectual aesthetic experience. (p.58)

Bio Art: From Genesis to Natural History of the Enigma

Figure 4.1 Eduardo Kac, Time Capsule, 1997. Microchip implant, simulcast on TV and the Web, remote scanning of the microchip through the Internet, photographs, X-Ray. Dimensions variable. Collection BEEP—Data Logic, Madrid. © Eduardo Kac.

I coined the phrase “bio art” in 1997, in reference to my own works that involved biological agency (as opposed to biological objecthood), such as Time Capsule2 (figure 4.1) and A-positive,3 both presented in 1997. The difference between biological agency and biological objecthood is that the first involves an active principle whereas the second implies material self-containment. In 1998 I introduced the phrase “transgenic art” in a paper-manifesto with the same title4 and proposed the creation (and social integration) of a dog expressing green fluorescent protein. This protein is commonly used as a biomarker in genetic research; however, my goal was to use it primarily for its visual properties as a symbolic gesture, a social marker. The initial public response to the paper was curiosity laced with incredulity. The proposal is perfectly viable, but it seemed that few believed the project could or would be realized. While I struggled to find venues that could assist me in creating the aforementioned project, entitled GFP K-9, I realized that canine reproductive technology was not developed enough at the time to enable me to create a dog expressing green fluorescent protein.5 In the meantime, I started to develop a new transgenic artwork, entitled Genesis, which premiered at Ars Electronica ’99.6

(p.59) Genesis

Genesis is a transgenic artwork that explores the intricate relationship between biology, belief systems, information technology, dialogical interaction, ethics, and the Internet. The key element of the work is an “artist’s gene,” a synthetic gene that was created by translating a sentence from the biblical book of Genesis into Morse code, and converting the Morse code into DNA base pairs according to a conversion principle I developed specifically for this work. The sentence reads: “Let man have dominion over the fish of the sea, and over the fowl of the air, and over every living thing that moves upon the earth.” It was chosen for what it implies about the dubious notion—divinely sanctioned—of humanity’s supremacy over nature. Morse code was chosen because, as the first example of the use of radiotelegraphy, it represents the dawn of the information age—the genesis of global communication. The Genesis gene was incorporated into bacteria, which were shown in the gallery. Participants on the web could turn on an ultraviolet light in the gallery, causing real, biological mutations in the bacteria. This changed the biblical sentence in the bacteria. After the show, the DNA of the bacteria was translated back into Morse code, and then back into English. The mutation that took place in the DNA had changed the original sentence from the Bible. The mutated sentence was posted on the Genesis website. In the context of the work, the ability to change the sentence is a symbolic gesture: It means that we do not accept its meaning in the form we inherited it, and that new meanings emerge as we seek to change it.

While presenting Genesis, I also gave a public lecture in the context of the symposium “Life Science,” presented by Ars Electronica ’99. My lecture focused on the GFP K-9 proposal. To contextualize my presentation, I reviewed the long history of humandog domestication and partnership, and pointed out the direct and strong human influence on the evolution of the dog up to the present day. Emphasizing that there are no packs of poodles and chihuahuas running in the wild, and that the creation of the dog out of the wolf was a technology—a fact that we seemed to have lost awareness of—I proceeded to point out the complex relationship between dogs and humans throughout their long history together, going back at least fourteen thousand years according to archaeological records. While some showed support and appreciation for the work, others reacted against the project and voiced their position. The stage was set for a very productive dialogue, which was one of my original intentions. As I see it, the debate must go beyond official policymaking and academic research to encompass the general public, including artists. GFP K-9 was discussed in art magazines, books, science journals, daily papers, and general magazines. While specialized publications showed greater appreciation for GFP K-9, the response in the general media covered the whole gamut, from forthright rejection to consideration of multiple implications to unmistakable support. The shock generated by the proposal curiously (p.60)

Bio Art: From Genesis to Natural History of the Enigma

Figure 4.2 Eduardo Kac, Genesis, 1999. Transgenic work with live video, light box, microvideo camera, petri dish with Genesis gene, website. Edition of two. Dimensions variable. Collection Instituto Valenciano de Arte Moderno—IVAM, Valencia. © Eduardo Kac. See plate 8.

caused one critic to declare “the end of art.”7 As I see it, there’s no reason to see the beginning of a new art as the end of anything (figure 4.2, plate 8).

GFP Bunny

This pattern of response repeated itself, at a truly global scale, when I announced in 2000 the realization of my second transgenic work. Entitled GFP Bunny, the work comprises the creation of a green fluorescent rabbit (named Alba), the public dialogue generated by the project, and the social integration of the rabbit. This work was realized with the assistance of Louis Bec and Louis-Marie Houdebine. Louis Bec worked as the producer, coordinating the activities in France. Bec and I met at Ars Electronica (September 1999) and soon afterward he contacted Houdebine to propose the project on my behalf. Months later, in 2000, Alba was born, a gentle and healthy rabbit. As I stated in my paper entitled GFP Bunny,8 “transgenic art is a new art form based on (p.61) the use of genetic engineering to create unique living beings. This must be done with great care, with acknowledgment of the complex issues thus raised and, above all, with a commitment to respect, nurture, and love the life thus created.”

In June of 2000, GFP Bunny attracted local media in the south of France when Paul Vial, the former director of the French institute where Alba was born, used his authority to overrule the scientists who had worked on the project; he refused to let Alba go to Avignon and then come to my family in Chicago. Contrary to what many believe, there were no public protests. Vial made this arbitrary decision unilaterally. He never explained his reason for the refusal, and it remains unknown to this day. Bec and I denounced this censorship through the Internet and through interviews to the press.9 If the objective was to silence the media, the result backfired. GFP Bunny became a global media scandal after a front-page article appeared in the Boston Globe,10 sharing headlines with articles about the 2000 Olympics and U.S. presidential debates. Articles about Alba were published in all major countries, with wire services further spreading the news worldwide.11 Alba was also on the cover of Le Monde, the San Francisco Chronicle, and L’Espresso, among others. Der Spiegel and the Chicago Tribune dedicated full pages to GFP Bunny. She also appeared on the front page of the Arts section of the New York Times. Broadcasts by ABC TV, BBC Radio, and Radio France also brought the Alba story to the whole planet. The relentless response to GFP Bunny has been equally intense and fascinating, with fruitful debate and both strong opposition and support. From October 15, 2000 to December 2, 2004, the Alba Guestbook collected general opinions about the work and expressions of support to bring Alba home.12 Through lectures and symposia, Internet postings and email correspondence, the debate intensified and became richer, more subtle and nuanced, as I had hoped. The response to GFP Bunny constitutes extremely rich material, which I hope to revisit in the near future.

As part of my intercontinental custody battle to obtain Alba’s release, between December 3 and December 13, 2000, I staged a public campaign in Paris, which included lectures, broadcasts, public and private meetings, and the public placement of a series of seven posters. I placed individual posters in several neighborhoods, including: Le Marais, Quartier Latin, Saint Germain, Champs de Mars, Bastille, Montparnasse, and Montmartre. The posters reflect some of the readings afforded by GFP Bunny. They show the same image of Alba and myself together, each topped by a different French word: Art, Médias, Science, Éthique, Religion, Nature, Famille.13 Between December 3 and December 13, 2000, parallel to radio (Radio France and Radio France Internationale), print (Le Monde, Libération, Transfert, Ça M’intéresse, Nova), and television (Canal+, Paris Première) interviews and debates, I posted these images on the streets in an effort to intervene in the context of French public opinion and gather support for my cause to bring Alba home. I also engaged the public directly through (p.62) a series of lectures (Sorbonne,École Normale Superior,École Superior des Beaux Arts, Forum des Images) and through face-to-face conversations on the street sparked by the public’s interest. In total, I reached approximately 1.5 million people (about half of the population of Paris). This was an important step, as it allowed me to address the Parisian public directly. In 2001 I created The Alba Flag, a white flag with the green rabbit silhouette, and started to fly it in front of my Chicago-area house. The flag signals publicly the green bunny’s home, but most importantly it stands as a social marker, a beacon of her absence.

Continuing my efforts to raise awareness about Alba’s plight and to obtain her freedom, in 2002 I presented a solo exhibition entitled Free Alba!14 at the Julia Friedman Gallery in Chicago (May 3–June 15, 2002). Free Alba! included a large body of new work comprised of large-scale color photographs, drawings, prints, Alba flags, and Alba T-shirts. Seen together for the first time were the posters from my public interventions in Paris (2000), an Alba flag flying outside the gallery (2001), photographs that reclaim green bunny narratives circulated by global media (2001–2002), drawings that reflect on our closeness to the “animal other” (2001–2002) and Alba T-shirts that extend Alba’s cause beyond gallery walls (2002). Through the leitmotif of the green bunny, this exhibition explored the poetics of life and evolution. The story of GFP Bunny was adapted and customized by news organizations worldwide, often generating new narratives that, both intentionally and unintentionally, reinstated or overlooked the facts. My Free Alba! exhibition featured photographs in which I re-appropriated and re-contextualized this vast coverage, exhibiting the productive tension that is generated when contemporary art enters the realm of daily news. The photographs in this series dramatize the fact that the reception of GFP Bunny was complex, taking place across cultures and in diverse locations. I will continue to develop new strategies to make Alba’s case public and to pursue her liberation.

Parallel to this effort, transgenic art evolves. One new direction involves the creation of nanoscale three-dimensional structures built of amino acids. This “proteic art,” or “protein art,” can be experienced in many forms, including in vivo, in vitro, and expanded into other settings, such as rapid-prototype models and online navigational spaces. All of these forms, and many others, can be combined through new bio-interfaces. A prominent aspect of this path is the fact that these three-dimensional structures are assembled according to combinatory rules that follow strict biological principles (otherwise it is not possible to produce them), even if one invents and synthesizes a new protein. This constraint imposes a bio-morphology that offers a new and fascinating creative challenge. A second new direction involves complex interactive transgenic environments with multiple organisms and biobots (biological robots partially regulated by internal transgenic microorganisms). In what follows I offer a discussion of these developments, both of which I explored in 2001 (figure 4.3). (p.63)

Bio Art: From Genesis to Natural History of the Enigma

Figure 4.3 Eduardo Kac, Free Alba! (The New York Times), 2002. Color photograph mounted on aluminum with Plexiglas. Edition of five. 36 × 46.5 inches. Collection Alfredo Herzog da Silva, S ã o Paulo. © Eduardo Kac.

(p.64) Sculpting New Proteins

While the first phase of Genesis focused on the creation and the mutation of a synthetic gene through Web participation, the second phase, carried out in 2000–2001, focused on the protein produced by the synthetic gene, the Genesis protein,15 and on new works that examine the cultural implications of proteins as fetish objects. The Genesis protein is another step in the translation of the original biblical text, this time from the Genesis gene (itself encoding the English sentence) to a three-dimensional form made up of discrete parts (amino acids). The transmogrification of a verbal text into a sculptural form is laden with intersemiotic resonances that contribute to expand the historically rich intertextuality between word, image, and spatial form. The process of biological mutation extends it into time.

A critical stance is manifested throughout the Genesis project by following scientifically accurate methods in the real production and visualization of a gene and a protein that I have invented and which have absolutely no function or value in biology. Rather than explicating or illustrating scientific principles, the Genesis project complicates and obfuscates the extreme simplification and reduction of standard molecular biology descriptions of life processes, reinstating social and historical contextualization at the core of the debate. I appropriate the techniques of biotechnology to critique the language of science and its inherent ideologies, while developing transgenic art as an alternative means for individual expression. In its genomic and proteomic manifestations, the Genesis project continues to reveal new readings and possibilities.

Protein production is a fundamental aspect of life. Multiple research centers around the world are currently focusing their initiatives on sequencing, organizing, and analyzing the genomes of both simple and complex organisms, from bacteria to human beings. After genomics (the study of genes and their function) comes proteomics (the study of proteins and their function). Proteomics, the dominant research agenda in molecular biology in the postgenomic world, focuses on the visualization of the three-dimensional structure of proteins produced by sequenced genes.16 It is also concerned with the study of the structure and functionality of these proteins, among many other important aspects, such as similarity among proteins found in different organisms. The second phase of Genesis critically investigates the logic, the methods, and the symbolism of proteomics, as well as its potential as a domain of artmaking.

To arrive at the visualization of the Genesis protein, I first explored aspects of its two-dimensional structure.17 The next step was to compare the predicted folding pattern of the Genesis protein to another known protein to which it is similar: Chorion. With the goal of producing a tangible rendition of the nanostructure of the Genesis protein, I researched protein fold homology using the Protein Data Bank, operated by the Research Collaboratory for Structural Bioinformatics (RCSB). I then produced a digital visualization of the Genesis protein’s three-dimensional structure.18 This three-dimensional dataset was used to produce both digital and physical versions of (p.65) the protein. The digital version is a fully navigable web object rendered both as VRML (Virtual Reality Modeling Language) and PDB (Protein Data Bank) formats, to enable up-close inspection of its complex volumetric structure. The physical rendition is a small solid object produced via rapid-prototyping, to convey in tangible form the fragility of this molecular object.19 This object was used as a mold for casting the final form of the protein used in the creation of the Transcription Jewels.

Transcription Jewels is a set of two objects encased in a custom-made round wooden box. The word “transcription” is the term used in biology to name the process during which the genetic information is “transcribed” from DNA into RNA.20 One “jewel” is a 2-inch genie bottle in clear glass with gold ornaments and 65 mg of purified Genesis DNA inside. “Purified DNA” means that countless copies of the DNA have been isolated from the bacteria in which they were produced, then accumulated and filtrated in a vial. The gene is seen here out of the context of the body, its meaning intentionally reduced to a formal entity to reveal that without acknowledgment of the vital roles played by organism and environment, the “priceless” gene can become “worthless.” The other “jewel” is an equally small gold cast of the three-dimensional structure of the Genesis protein. By displaying the emblematic elements of the biotech revolution (the gene and the protein) as coveted valuables, Transcription Jewels makes an ironic commentary on the commodification of the most minute aspects of life. Neither the purified gene in Transcription Jewels nor its protein is derived from a natural organism; each was created specifically for the artwork Genesis. Instead of a “genie” inside the bottle one finds the new panacea, the gene. No wishes of immortality, beauty, or intelligence are granted by the inert and isolated gene sealed inside the miniature bottle. As a result, the irony gains a critical and humorous twist by the fact that the “precious commodity” is devoid of any real, practical application in biology.

All pieces described and discussed above were presented together in my solo exhibition Genesis, realized at Julia Friedman Gallery, in Chicago, from May 4 to June 2, 2001. The multiple mutations experienced biologically by the bacteria and graphically by the images, texts, and systems that compose the exhibition reveal that the alleged supremacy of the so-called master molecule must be questioned. The Genesis series (including the living transgenic work, Transcription Jewels, and other works) challenges the genetic hype and opposes the dominant biodeterministic interpretation, stating that we must continue to consider life as a complex system at the crossroads between belief systems, economic principles, legal parameters, political directives, scientific laws, and cultural constructs.

The Eighth Day

The Eighth Day is a transgenic artwork that investigates the new ecology of fluorescent creatures that is evolving worldwide. It was shown from October 25 to November 2, 2001, at the Institute for Studies in the Arts, Arizona State University, Tempe.21 While (p.66) fluorescent creatures are being developed in isolation in laboratories, seen collectively in this work for the first time they form the nucleus of a new and emerging synthetic bioluminescent ecosystem. The piece brings together living transgenic life forms and a biological robot (biobot) in an environment enclosed under a clear Plexiglas dome, thus making visible what it would be like if these creatures would in fact coexist in the world at large.

As the viewer walks into the gallery, she first sees a blue-glowing semisphere against a dark background. This semisphere is the four-foot dome, aglow with its internal blue light. She also hears the recurring sounds of water washing ashore. This evokes the image of the Earth as seen from space. The water sounds both function as a metaphor for life on Earth (reinforced by the spherical blue image) and resonate with the video of moving water projected on the floor. In order to see The Eighth Day the viewer is invited to “walk on water.”

In the gallery, visitors are able to see the terrarium with transgenic creatures from both inside and outside the dome. As they stand outside the dome looking in, someone online sees the space from the perspective of the biobot looking out, perceiving the transgenic environment as well as faces or bodies of local viewers. An online computer in the gallery also gives local visitors an exact sense of what the experience is like remotely on the Internet.

Local viewers may temporarily believe that their gaze is the only human gaze contemplating the organisms in the dome. However, once they navigate the Web interface they realize that remote viewers can also experience the environment from a bird’s eye point of view, looking down through a camera mounted above the dome. They can pan, tilt, and zoom, seeing humans, mice, plants, fish, and the biobot up close. Thus, from the point of view of the online participant, local viewers become part of the ecology of living creatures featured in the work, as if enclosed in a Websphere.

The Eighth Day presents an expansion of biodiversity beyond wildtype life forms. As a self-contained artificial ecology it resonates with the words in the title, which add one day to the period of creation of the world as narrated in Judeo-Christian scripture. All of the transgenic creatures in The Eighth Day are created with the same gene I used previously in GFP Bunny to create Alba, a gene that allows all creatures to glow green under harmless blue light. The transgenic creatures in The Eighth Day are GFP plants, GFP amoeba, GFP fish, and GFP mice. Selective breeding and mutation are two key evolutionary forces. The Eighth Day literally plays a role in transgenic evolution, since all organisms in the piece are mutations of their respective wildtype species and all were selected and bred for their GFP mutations.

The Eighth Day also includes a biological robot. A biobot is a robot with an active biological element within its body that is responsible for aspects of its behavior. The biobot created for The Eighth Day has a colony of GFP amoeba called Dyctiostelium (p.67) discoideum as its “brain cells.” These “brain cells” form a network within a bioreactor that constitutes the “brain structure” of the biobot. When amoebas divide, the biobot exhibits dynamic behavior inside the enclosed environment. Changes in the amoebal colony (the “brain cells”) of the biobot are monitored by it, and cause it to move about, throughout the exhibition. The biobot also functions as the avatar of Web participants inside the environment. Independent of the ascent and descent of the biobot, Web participants are able to control its audiovisual system with a pan-tilt actuator. The autonomous motion, which often causes the biobot to lean forward in different directions, provides Web participants with new perspectives of the environment.

The biobot’s “amoebal brain” is visible through the transparent bioreactor body. In the gallery, visitors are able to see the terrarium with transgenic creatures from outside and inside the dome, as a computer in the gallery gives local visitors an exact sense of what the experience is like on the Internet. By enabling participants to experience the environment inside the dome from the point of view of the biobot, The Eighth Day creates a context in which participants can reflect on the meaning of a transgenic ecology from a first-person perspective (figure 4.4, plate 9).

Move 36

Move 36 makes reference to the dramatic move made by the computer Deep Blue against world-champion chess master Gary Kasparov in 1997.22 This competition can be characterized as a match between the greatest chess player who ever lived and the greatest chess player who never lived. The work—presented for the first time at the Exploratorium, in San Francisco, from February 26 to May 31, 2004—sheds light on the limits of the human mind and the increasing capabilities developed by computers and robots, inanimate beings whose actions often acquire a force comparable to subjective human agency.

According to Kasparov, Deep Blue’s quintessential moment in Game 2 ame at move 36. Rather than making a move that was expected by viewers and commentators alike—a sound move that would have afforded immediate gratification—it made a move that was subtle and conceptual and, in the long run, better. Kasparov could not believe that a machine had made such a keen move. The game, in his mind, was lost.

The work presents a chessboard made of earth (dark squares) and white sand (light squares) in the middle of the room. There are no chess pieces on the board. Positioned exactly where Deep Blue made its move 36 is a plant whose genome incorporates a new gene that I created specifically for this work. The gene uses ASCII (the universal computer code for representing binary numbers as Roman characters, on- and off-line) to translate to the four bases of genetics Descartes’s statement: “Cogito ergo sum” (I think, therefore I am). (p.68)

Bio Art: From Genesis to Natural History of the Enigma

Figure 4.4 Eduardo Kac, The Eighth Day, 2001. Transgenic work with live video, blue lights, sound, biological robot, water, GFP organisms (plants, mice, fish, amoeba), website. Dimensions variable. © Eduardo Kac. See plate 9.

(p.69) Through genetic modification, the leaves of the plants grow multiple plantlets. In the wild these leaves would be smooth. The “Cartesian gene” was coupled with a gene for the expression of the plantlets, so that the public can easily see with the naked eye that the “Cartesian gene” is expressed precisely where the plantlets grow.

The “Cartesian gene” was produced according to a new code I created especially for the work. In 8-bit ASCII, the letter C, for example, is 01000011. Thus, the gene is created by the following association between genetic bases and binary digits:

  • A = 00

  • C = 01

  • G = 10

  • T = 11

The result is the following gene with 52 bases:

  • CAATCATTCACTCAGCCCCACATTCACCCCAGCACTCATTCCATCCCCCATC

The creation of this gene is a critical and ironic gesture, since Descartes considered the human mind a “ghost in the machine” (for him the body was a “machine”). His rationalist philosophy gave new impetus both to the mind–body split (Cartesian dualism) and to the mathematical foundations of current computer technology.

The presence of this “Cartesian gene” in the plant, rooted precisely where the human lost to the machine, reveals the tenuous border between humanity, inanimate objects endowed with lifelike qualities, and living organisms that encode digital information. A single, focused light shines in a delicate luminous cone over the plant. Silent video projections on two opposing walls contextualize the work, evoking two chess opponents in absentia. Each video projection is composed of a grid of small squares, resembling a chess board. Each square shows short animated loops cycling at different intervals, thus creating a complex and carefully choreographed thread of movements. The cognitive engagement of the viewer with the multiple visual possibilities presented on both projected boards subtly emulates the mapping of multiple paths on the board involved in a chess match.

A game for phantasmic players, a philosophical statement uttered by a plant, a sculptural process that explores the poetics of real life and evolution: This work gives continuity to my ongoing interventions at the boundaries between the living (human, nonhuman animals) and the nonliving (machines, networks). Checkmating traditional notions, nature is revealed as an arena for the production of ideological conflict, and the physical sciences as a locus for the creation of science fictions.

(p.70) Specimen of Secrecy about Marvelous Discoveries

Specimen of Secrecy about Marvelous Discoveries is a series of works comprised of what I call “biotopes,” that is, living pieces that change during the exhibition in response to internal metabolism and environmental conditions, including temperature, relative humidity, airflow, and light levels in the exhibition space.23 Each of my biotopes is a genuine ecology made up of thousands of microscopic living beings in a medium of earth, water, and other materials. I orchestrate the metabolism of this diverse microbial life in order to produce the constantly evolving living works.

My biotopes expand on ecological and evolutionary issues I previously explored in transgenic works such as The Eighth Day. At the same time, the biotopes further develop dialogical principles that have been central to my work for over two decades.

The biotopes are a discrete ecology because within their world the microorganisms interact with and support each other (that is, the activities of one organism enable another to grow, and vice versa). However, they are not entirely secluded from the outside world: The aerobic organisms within the biotope absorb oxygen from outside (while the anaerobic ones comfortably migrate to regions where air cannot reach).

A complex set of relationships emerges as the work unfolds, bringing together the internal dialogical interactions among the microorganisms in the biotope and the interaction of the biotope as a discrete unit with the external world.

The biotope is what I call a “nomad ecology,” that is, an ecological system that interacts with its surroundings as it travels around the world. Every time a biotope migrates from one location to another, the very act of transporting it causes an unpredictable redistribution of the microorganisms inside it (because of the constant physical agitation inherent in the course of a trip). Once in place, the biotope self-regulates with internal migrations, metabolic exchanges, and material settling. Extended presence in a single location might yield a different behavior, possibly resulting in regions of settlement and color concentration.

The biotope is affected by several factors, including the very presence of viewers, which can increase the temperature in the room (warm bodies) and release other microorganisms in the air (breathing, sneezing).

I consider the exhibition’s opening as the birth of a given biotope. Once an exhibition begins, I allow the microorganisms in suspended animation to become active again. From that point on I no longer intervene. The work becomes progressively different, changing every day, every week, every month.

When the viewer looks at a biotope, she sees what could be described as an image. However, since this image is always evolving into its next transformative state, the perceived stillness is more a consequence of the conditions of observation (limits of the human perception, ephemeral presence of the viewer in the gallery) than an internal material property of the biotope. Viewers looking at the biotope another day (p.71) will see a different image. Given the cyclical nature of this image, each image seen at a given time is but a moment in the evolution of the work, an ephemeral snapshot of the biotope metabolic state, a scopic interface for human intimacy.

Each of my “biotopes” explores what I call “biological time,” which is time manifested throughout the life cycle of a being itself, in vivo (contrary to, say, the frozen time of painting or photography, the montaged time of film or video, or the real time of a telecommunications event).

This open process continuously transforms the image and may, depending on factors such as lighting conditions and exhibition length, result in its effacement— until the cycle begins again.

The biotope has a cycle that starts when I produce the self-contained body by integrating microorganisms and nutrient-rich media. In the next step, I control the amount of energy the microorganisms receive in order to keep some of them active and others in suspended animation. This results in what the viewer may momentarily perceive as a still image. However, even if the image seems still, the work is constantly evolving and is never physically the same. Only time-lapse video can reveal the transformation undergone by a given biotope in the course of its slow change and evolution.

To think of a biotope only in terms of microscopic living beings is extremely limiting. Although it is also possible to describe a human being in terms of cells, a person is much more than an agglomerate of cells. A person is a whole, not merely the sum of parts. We shall not confuse our ability to describe a living entity in a given manner (e.g., as an object composed of discrete parts) with the phenomenological consideration of what it is like to be that entity, for that entity. The biotope is a whole. Its presence and overall behavior is that of a new entity that is at once an artwork and a new living being. It is with this bioambiguity that it manifests itself. It is as a whole that the biotope behaves and seeks to satisfy its needs. The biotope asks for light and, occasionally, water. In this sense, it is an artwork that asks for the participation of the viewer in the form of personal care. Like a pet, it will provide companionship and produce more colors in response to the care it receives. Like a plant, it will respond to light. Like a machine, it is programmed to function according to a specific feedback principle (e.g., expose it to the proper amount of heat and it will grow). Like an object, it can be boxed and transported. Like an animal with an exoskeleton, it is multicellular, has a fixed bodily structure, and is singular. What is the biotope? It is its plural ontological condition that makes it unique.

Natural History of the Enigma

The central work in the Natural History of the Enigma series is a plantimal, a new life form I created and that I call “Edunia,” a genetically engineered flower that is a (p.72) hybrid of the petunia and myself. The Edunia expresses my DNA exclusively in its red veins.

Developed between 2003 and 2008, and first exhibited from April 17 to June 21, 2009, at the Weisman Art Museum24 in Minneapolis, Natural History of the Enigma also encompasses a large-scale public sculpture, a print suite, photographs, and other works.

The new flower is a petunia strain that I invented and produced through molecular biology. It is not found in nature. The Edunia has red veins on light pink petals and a gene of mine is expressed on every cell of its red veins; that is, my gene produces a protein in the veins only.25 The gene was isolated and sequenced from my blood. The petal pink background, against which the red veins are seen, is evocative of my own pinkish-white skin tone. The result of this molecular manipulation is a bloom that creates the living image of human blood rushing through the veins of a flower.

The gene I selected is responsible for the identification of foreign bodies. In this work, it is precisely that which identifies and rejects the other that I integrate into the other, thus creating a new kind of self that is partially flower and partially human.

Natural History of the Enigma is a reflection on the contiguity of life between different species. It uses the redness of blood and the redness of the plant’s veins as a marker of our shared heritage in the wider spectrum of life. By combining human and plant DNA in a new flower, in a visually dramatic way (red expression of human DNA in the flower’s veins), I bring forth the realization of the contiguity of life between different species.

This work seeks to instill in the public a sense of wonder about this most amazing of phenomena we call “life.” The general public may have no difficulty in considering how close we truly are to apes and other nonhuman animals, particularly those with which it is possible to communicate directly, such as cats and dogs. However, the thought that we are also close to other life forms, including flora, will strike most as surprising.

While in the history of art one finds imaginative associations between anthropomorphic and botanical forms (as in the work of Archimboldo, for example), this parallel (between humans and plants) also belongs to the history of philosophy and to contemporary science. Advancing notions first articulated by Descartes, Julien Offray de La Mettrie (1709–1751) already proposed in his book L’homme plante [Man a Plant] (1748) that “the singular analogy between the plant and animal kingdoms has led me to the discovery that the principal parts of men and plants are the same.” The preliminary sequencing of the human genome and that of a plant from the mustard family (Arabidopsis thaliana, in the journal Nature, December 14, 2000) have extended the artist ’s and the philosopher’s analogies beyond their wildest dreams, into the (p.73) deepest recesses of the human and plant cells. Both have revealed homologies between human and plant genetic sequences.

Thus, the key gesture of Natural History of the Enigma takes place at the molecular level. It is at once a physical realization (i.e., a new life created by an artist, tout court) and a symbolic gesture (i.e., ideas and emotions are evoked by the very existence of the flower).

I had a sample of my blood drawn, and subsequently isolated a genetic sequence that is part of my immune system—the system that distinguishes self from nonself, that is, protects against foreign molecules, disease, invaders—anything that is not me. To be more precise, I isolated a protein-coding sequence of my DNA from my immunoglobulin (IgG) light chain (variable region).26

To create a petunia with red veins in which my blood gene is expressed I made a chimeric gene composed of my own DNA and a promoter to guide the red expression only in the flower vascular system. To make my blood-derived DNA express only in the red veins of the petunia, I used Professor Neil Olszewski’s CoYMV (Commelina Yellow Mottle Virus) Promoter, which drives gene expression only in plant veins. Professor Olszewski is in the Department of Plant Biology at the University of Minnesota, St. Paul.27

My IgG DNA is integrated into the chromosome of the Edunia. This means that every time that the Edunia is propagated through seeds my gene is present in the new flowers.

The sculpture that is part of Natural History of the Enigma, entitled Singularis, is a three-dimensional fiberglass and metal form measuring 14′4″ (height) × 20′4″ (length) × 8′5″(width). It contrasts the minute scale of the molecular procedure with the largerthan-life structure. Likewise, the work pairs the ephemeral quality of the living organism with the permanence of the large sculpture. The sculpture is directly connected to the flower because its form is an enlargement of unique forms found inside this invented flower. In other words, the sculpture is derived from the molecular procedure employed to create the flower.28 In its hybridity, the sculpture reveals the proximity of our next of kin in the kingdom Plantae.

I used 3D imaging and rapid-prototyping to visualize this fusion protein as a tangible form. I created the visual choreography of the sculpture based on the flower’s molecular uniqueness. The sculpture was created with a vocabulary of organic twists and turns, helices, sheets, and other three-dimensional features common to all life. The sculpture is blood red, in connection with the starting point of the work (my blood) and the veinal coloration of the Edunia.

In anticipation of a future in which Edunias can be distributed and planted everywhere, I created a set of six lithographs entitled Edunia Seed Pack Studies. Visually resonant as they are with the flower and the work’s theme, these images are meant to be (p.74) used in the actual seed packs to be produced in the future. In my exhibition at the Weisman Art Museum, I exhibited a limited edition of Edunia seed packs containing actual Edunia seeds. All works mentioned above (Singularis, Edunia Seed Pack Studies, and Edunia Seed Packs) are in the permanent collection of the Weisman Art Museum. This means that the new organism itself, in its germinal state, is in the collection (figure 4.5).

Conclusion

Quite clearly, genetic engineering will continue to have profound consequences in art as well as in the social, medical, political, and economic spheres of life. As an artist I am interested in reflecting on the multiple social implications of genetics— from unacceptable abuse to its hopeful promises, from the notion of “code” to the question of translation, from the synthesis of genes to the process of mutation, from the metaphors used by biotechnology to the fetishization of genes and proteins, from simple reductive narratives to complex views that account for environmental influences. The urgent task is to unpack the implicit meanings of the biotechnology revolution and contribute to the creation of alternative views, thus changing genetics into a critically aware new art medium.

The tangible and symbolic coexistence of the human and the transgenic, which I have developed in several of my works discussed above, shows that humans and other species are evolving in new ways. It dramatizes the urgent need to develop new models with which to understand this change, and calls for the interrogation of difference, taking into account clones, transgenics, and chimeras.

The Human Genome Project (HGP) has made it clear that all humans have acquired, through a long evolutionary history, genetic sequences that came from viruses.29 This shows that we have in our bodies DNA from nonhuman organisms. Ultimately, this means that we too are transgenic. Before deciding that all transgenics are “monstrous,” humans must look within and come to terms with our own “monstrosity,” that is, with our own transgenic condition.

The common perception that transgenics are not “natural” is incorrect. It is important to understand that the process of moving genes from one species to another is part of wild life (without human participation). The most common example is the bacterium called “agrobacterium,” which enters the root of plants and communicates its genes to it. Agrobacterium has the ability to transfer DNA into plant cells and integrate the DNA into the plant chromosome.30

Transgenic art suggests that romantic notions of what is “natural” have to be questioned and the human role in the evolutionary history of other species (and vice versa) has to be acknowledged, while at the same time respectfully and humbly marveling at this amazing phenomenon we call “life.” (p.75)

Bio Art: From Genesis to Natural History of the Enigma

Figure 4.5 Eduardo Kac, Natural History of the Enigma, 2003/2008. Transgenic flower with artist’s own DNA expressed in the red veins of the petals. Dimensions variable. Collection Weisman Art Museum, Minneapolis. © Eduardo Kac.

Bio Art: From Genesis to Natural History of the Enigma

Plate 8 Eduardo Kac, Genesis, 1999. Transgenic work with live video, light box, microvideo camera, petri dish with Genesis gene, website. Edition of two. Dimensions variable. Collection Instituto Valenciano de Arte Moderno—IVAM, Valencia. © Eduardo Kac.

Bio Art: From Genesis to Natural History of the Enigma

Plate 9 Eduardo Kac, The Eighth Day, 2001. Transgenic work with live video, blue lights, sound, biological robot, water, GFP organisms (plants, mice, fish, amoeba), website. Dimensions variable. © Eduardo Kac.

Notes:

(1.) See Eduardo Kac, Luz & Letra: Ensaios de arte, literatura e comunicação (Light & Letter: Essays in art, literature, and communication) (Rio de Janeiro: Editora Contra Capa, 2004); Eduardo Kac, Telepresence and Bio Art—Networking Humans, Rabbits, and Robots (Ann Arbor: University of Michigan Press, 2005). See also 〈http://www.ekac.org〉.

(2.) Robert Atkins, “State of the (On-Line) Art,” Art in America (April 1999): 89–95; Mario Cesar Carvalho, “Artista implanta hoje chip no corpo,” Folha de São Paulo, Cotidiano (November 11, 1997): 3; Michel Cohen, “The Artificial Horizon: Notes Towards a Digital Aesthetics,” in Luna’s Flow: The Second International Media Art Biennale, ed. Wonil Rhee (media_city seoul 2002, Seoul Museum of Art, Seoul, Korea, 2002), 20, 32–33; Patricia Decia, “Bioarte: Eduardo Kac tem obra polêmica vetada no ICI,” Folha de São Paulo, Ilustrada (October 10, 1997): 13; Steve Dietz, “Memory_Archive_Database,” Switch 5, no. 3 (2000), 〈http://switch.sjsu.edu〉; Steve Dietz, “Hotlist,” Artforum (October 2000): 41; Luis Esnal, “Un hombre llamado 026109532,” La Nacion (December 15, 1997), Section 5, 8; Eduardo Kac, “Time Capsule,” InterCommunication 26 (autumn 1998): 13–15; “Time Capsule,” in Database Aesthetics, ed.Victoria Vesna, Karamjit S. Gill, and David Smith, vol. 14, no. 2 (special issue of AI & Society, 2000), 243–249; “Art at the Biological Frontier,” in Reframing Consciousness: Art, Mind, and Technology, ed. Roy Ascott (Exeter: Intellect, 1999), 90–94; “Capsule Temporelle,” in L’Archivage Comme Activité Artistique/Archiving as Art, ed. Karen O’Rourke (Paris: University of Paris, 2000), n.p.; Arlindo Machado, “A Microchip inside the Body,” Performance Research 4, no. 2 (“Online” special issue, London, 1999): 8–12; Christiane Paul, “Time Capsule,” Intelligent Agent 2, no. 2 (1998): 4–13; Julia Scheeres, “New Body Art: Chip Implants,” Wired News, March 11, 2002; Maureen P. Sherlock, “Either/Or/Neither/Nor,” in Future Perspectives, exhibition by Marina Grzinic, Gallery (Dante) Marino Cettina (Umag, Croatia: Marino Cettina Gallery, 2001), 130–135; Kristine Stiles, “Time Capsule,” in Uncorrupted Joy: Art Actions, Art History, and Social Value (Berkeley: University of California Press, 2003); Stephanie Strickland, “Dalí Clocks: Time Dimensions of Hypermedia,” Electronic Book Review, no. 11, 2000; Steve Tomasula, “Time Capsule : Self-Capsule,” CIRCA 89 (autumn 1999): 23–25.

(3.) Gisele Beiguelman, “Artista discute o pós-humano,” Folha de São Paulo, October 10, 1997; Patricia Decia, “Artista põe a vida em risco” e “Bioarte,” Folha de São Paulo, October 10, 1997; James Geary, The Body Electric: An Anatomy of the New Bionic Senses (New Brunswick, NJ: Rutgers University Press, 2002), 181–185; Eduardo Kac, “A-positive,” in ISEA ’97—The Eighth International Symposium on Electronic Art, September 22–27, 1997 (Chicago: The School of the Art Institute of Chicago, 1997), 62; Eduardo Kac, “A-positive: Art at the Biobotic Frontier,” Flyer distributed on the occasion of ISEA ’97; Eduardo Kac, “Art at the Biologic Frontier,” in Reframing Consciousness, ed. Roy Ascott (Exeter: Intellect, 1999), 90–94; Arlindo Machado, “Expanded Bodies and Minds,” in Eduardo Kac: Teleporting An Unknown State, ed. Peter Tomaz Dobrila and Aleksandra Kostic (Maribor, Slovenia: KIBLA, 1998), 39–63; Matthew Mirapaul, “An Electronic Artist and His Body of Work,” New York Times, October 2, 1997; Simome Osthoff, “From Stable Object to Participating Subject: Content, Meaning, and Social Context at ISEA97,” New Art Examiner (February 1998):, 18–23.

( (p.77) 4.) Eduardo Kac, “Transgenic Art,” Leonardo Electronic Almanac 6, no. 11 (1998). See also 〈http://www.ekac.org/transgenic.html〉. Republished in Ars Electronica ’99—Life Science, ed. Gerfried Stocker and Christine Schopf (Vienna: Springer, 1999), 289–296.

(5.) In 1998, canine reproductive technology was not developed enough to enable the creation of a transgenic or cloned dog. However, research was already underway to both map the dog genome and to develop canine in-vitro fertilization. In 2005, scientists successfully cloned a dog at Seoul National University, Korea. Although the lead researcher (Woo Suk Hwang) was proven guilty of falsifying data in the field of stem cell research, the dog-cloning research was proven successful and has become internationally accepted. The research is not very practical and cannot be easily adapted, but further streamlining led to a budding dog-cloning business. This unique research stands to demonstrate that “GFP K-9” is possible.

(6.) Eduardo Kac, “Genesis,” Ars Electronica ’99—Life Science, 310–313. See also: 〈http://www.ekac.org/geninfo.html〉. Genesis was carried out with the assistance of Dr. Charles Strom, formerly Director of Medical Genetics, Illinois Masonic Medical Center, Chicago. Dr. Strom is now Medical Director, Biochemical and Molecular Genetics Laboratories Nichols Institute/Quest Diagnostics, San Juan Capistrano, California. Original DNA music for Genesis was composed by Peter Gena.

(7.) Charles Mudede, “The End of Art,” The Stranger 9, no. 15 (Dec. 30, 1999–Jan. 5, 2000).

(8.) Eduardo Kac, “GFP Bunny,” in Eduardo Kac, Telepresence, Biotelematics, and Transgenic Art, ed. Peter Tomaz Dobrila and Aleksandra Kostic (Maribor, Slovenia: KIBLA, 2000), 101–131. See also 〈http://www.ekac.org/gfpbunny.html〉.

(9.) I had proposed to live for one week with Alba in the Grenier à Sel, in Avignon, where Louis Bec directed the art festival “Avignon Numérique.” In an email broadcast in Europe on June 16, 2000, Bec wrote: “Contre notre volonté, le programme concernant «Artransgénique», qui devait se dérouler du 19 au 25 juin, se trouve modifié. Une décision injustifiable nous prive de la présence de Bunny GFP, le lapin transgénique fluorescent que nous comptions présenter aux Avignonnais et à l’ensemble des personnes intéressées par les évolutions actuelles des pratiques artistiques. Malgré cette censure déguisée, l’artiste Eduardo Kac, auteur de ce projet, sera parmi nous et présentera sa démarche ainsi que l’ensemble de ses travaux. Un débat public permettra d’ouvrir une large réflexion sur les transformations du vivant opérées par les biotechnologies, tant dans les domaines artistiques et juridiques, qu’éthiques et économiques. Nous élevons de toute évidence contre le fait qu’il soit interdit aux citoyens d avoir accès aux développements scientifiques et culturels qui les concernent si directement.” [“Against our will, the transgenic art program, originally scheduled for June 19–20, has been changed. An unjustifiable decision prevents us from enjoying the presence of GFP Bunny, the transgenic florescent rabbit we intended to present to the people of Avignon and the general public interested in the evolution of contemporary art. In spite of this disguised censorship, the artist Eduardo Kac, author of this project, will be among us and will present this work, as well as his larger body of work. A public debate will allow us to reflect on the ongoing transformations of life operated by biotechnology in the artistic, legal, ethical, and economic domains. We firmly oppose that citizens are being prevented from gaining access to these cultural and scientific developments that are so relevant to them.”]

( (p.78) 10.) Gareth Cross. “Cross Hare: Hop and Glow,” Boston Globe, September 17, 2000, A01. The article states: “Kac and Alba remain apart while Kac tries to persuade the French government laboratory, called the National Institute of Agronomic Research, to grant him custody of the bunny. The scientist who created her for Kac, Louis-Marie Houdebine, said he doesn’t know when, or if, Alba will be allowed to join Kac, but said that she is healthy, and even noted that she has a ‘particularly mellow and sweet disposition.’”

(11.) For a bibliography on transgenic art, see 〈http://www.ekac.org/transartbiblio.html〉.

(13.) These posters have also been shown in gallery exhibitions: “Dystopia + Identity in the Age of Global Communications,” curated by Cristine Wang, Tribes Gallery, New York (2000); “Under the Skin,” curated by Söke Dinkla, Renate Heidt Heller, and Cornelia Brueninghaus-Knubel, Wilhelm Lehmbruck Museum, Duisburg (2001); “International Container Art Festival,” Kaohsiung Museum of Fine Arts, Taiwan (Dec. 8, 2001–January 6, 2002); “Portão 2,” Galeria Nara Roesler, S ã o Paulo, Brazil (March 21–April 27, 2002); “Free Alba!,” Julia Friedman Gallery, Chicago (May 3–June 15, 2002); “Eurovision—I Biennale d’Arte: DNArt; Transiti: Metamorfosi: Permanenze,” Kunsthaus Merano Arte, Merano, Italy (June 15–August 15, 2002); “Gene(sis): Contemporary Art Explores Human Genomics,” Henry Art Gallery, Seattle (April 6–August 25, 2002; “Face/off—Body Fantasies,” Kunst und Kunstgewerbeverein, Pforzheim, Germany (February–May 2004); “Gene(sis): Contemporary Art Explores Human Genomics,” Frederick Weisman Museum of Art, Minneapolis (January 25–May 2, 2004).

See also the following catalogs: Under the Skin (Ostfilden-Ruit, Germany: Hatje Cantz Verlag, 2001), 60–63; Eurovision—I Biennale d’Arte: DNArt; Transiti: Metamorfosi: Permanenze (Milan: Rizzoli, 2002), 104–105; International Container Art Festival (Kaohsiung: Kaohsiung Museum of Fine Arts, 2002), 86–87.

(14.) Lisa Stein, “New Kac Show Takes a Look at Ethics, Rabbit,” Chicago Tribune, May 10, 2002, 21.

(15.) In actuality, genes do not “produce” proteins. As Richard Lewontin clearly explains: “A DNA sequence does not specify protein, but only the amino acid sequence. The protein is one of a number of minimum free-energy foldings of the same amino acid chain, and the cellular milieu together with the translation process influences which of these foldings occurs.” See: R. C. Lewontin, “In the Beginning Was the Word,” Science 291, no. 16 (February 2001): 1264.

(16.) In 1985 I purchased an issue of a magazine entitled High Technology whose cover headline read “Protein Engineering: Molecular Creations for Industry and Medicine.” Clearly, the desire to “design” new molecular forms has been evolving for approximately two decades. See Jonathan B. Tucker, “Proteins to Order: Computer Graphics and Gene Splicing Are Helping Researchers Create New Molecules for Industry and Medicine,” High Technology 5, no. 12 (December 1985): 26–34. A few months before, I had published an article in which I discussed an art of the future, which would “develop a new form of expression in a space minimized to the highest degree.” See “A Arte eletrônica em espaço microscópico (Electronic art in microscopic space),” Módulo 87 (September 1985): 49.

( (p.79) 17.) Special thanks to Dr. Murray Robinson, Head of Cancer Program, Amgen, Thousand Oaks, California.

(18.) Protein visualization was carried out with the assistance of Charles Kazilek and Laura Eggink, BioImaging Laboratory, Arizona State University, Tempe.

(19.) Rapid prototyping was developed with the assistance of Dan Collins and James Stewart, Prism Lab, Arizona State University, Tempe.

(20.) Terms like “transcription,” as well as “code,” “translation,” and many others commonly employed in molecular biology, betray an ideological stance, a conflation of linguistic metaphors and biological entities, whose rhetorical goal is to instrumentalize processes of life. In the words of Lily E. Kay, this merger integrates “the notion of the genetic code as relation with that of a DNA code as thing.” See Lily E. Kay, Who Wrote the Book of Life: A History of the Genetic Code (Stanford, CA: Stanford University Press, 2000), 309. For a thorough critique of the rhetorical strategies of molecular biology, see Richard Doyle, On Beyond Living: Rhetorical Transformations of the Life Sciences (Stanford, CA: Stanford University Press, 1997).

(21.) I developed The Eighth Day through a two-year residency at the Institute of Studies in the Arts, Arizona State University, Tempe. The exhibition ran from October 25 to November 2, 2001, at the Computer Commons Gallery, Arizona State University, Tempe (with the support of the Institute of Studies in the Arts). Documentation can be found at 〈http://www.ekac.org/8thday.html〉. See The Eighth Day: The Transgenic Art of Eduardo Kac, ed. Sheilah Britton and Dan Collins (New York: Arizona State University Press/distributed by DAP, 2003).

(22.) See Elena Giulia Rossi, Eduardo Kac: Move 36 (Paris: Filigranes Éditions, 2005).

(23.) “Specimen of Secrecy about Marvelous Discoveries” premiered at the Singapore Biennale (September 4–November 12, 2006).

(24.) The exhibition was comprised of the actual Edunias, the complete Edunia Seed Pack set of six lithographs, and a limited edition of Edunia seed packs with actual Edunia seeds.

(25.) The gene of mine I used is an IgG fragment. Immunoglobulin G (IgG) is a kind of protein that functions as an antibody. IgG is found in blood and other bodily fluids, and is used by the immune system to identify and neutralize foreign antigens. An antigen is a toxin or other foreign substance that provokes an immune response in the body, such as viruses, bacteria, and allergens. More precisely, my DNA fragment is from my immunoglobulin kappa light chain (IGK). In Natural History of the Enigma, the fusion protein, produced exclusively in the red veins, is a fusion of my IgG fragment with GUS (an enzyme that allowed me to confirm the vascular expression of the gene).

(26.) For her assistance in drawing my blood, isolating my IgG and cloning it, I owe a debt of gratitude to Bonita L. Baskin, who was, at the time I carried out this work, the CEO of Apptec Laboratory Services, St. Paul, Minnesota. The blood was drawn for Natural History of the Enigma on May 13, 2004, at Apptec Laboratory Services.

( (p.80) 27.) With the assistance of Professor Neil Olszewski, I obtained positive confirmation that my IgG protein was produced only in the Edunia veins by detecting the activity of the enzyme GUS (beta glucuronidase), which is fused to the IgG sequence. The detection was achieved through a staining technique.

(28.) The sculpture’s form is an invented protein composed of human and plant parts. The human part is a fragment of my IgG light chain (variable region); the plant component is from the petunia’s ANTHOCYANIN1 (AN1), responsible for red pigmentation in the flower. More precisely, AN1 is a transcription factor that controls genes encoding the enzymes that produce the red pigments.

(29.) See T. A. Brown, Genomes (Oxford: Bios Scientific Publishers, 1999), 138; and David Baltimore, “Our Genome Unveiled,” Nature 409, no. 15 (February 2001), 814–816. In private email correspondence (January 28, 2002), and as a follow-up to our previous conversation on the topic, Dr. Jens Reich, Division of Genomic Informatics of the Max Delbruck Center in Berlin-Buch, stated: “The explanation for these massive [viral] inserts into our genome (which, incidentally, looks like a garbage bin anyway) is usually that these elements were acquired into germ cells by retrovirus infection and subsequent dispersion over the genome some 10 to 40 millions ago (as we still were early apes).” The HGP also suggests that humans have hundreds of bacterial genes in the genome. See “Initial Sequencing and Analysis of the Human Genome,” International Human Genome Sequencing Consortium 409, no. 6822 (February 15, 2001): 860. Of the 223 genes coding for proteins that are also present in bacteria and in vertebrates, 113 cases are believed to be confirmed. See p. 903 of the same issue. In the same correspondence mentioned above, Dr. Reich concluded: “It appears that it is not man, but all vertebrates who are transgenic in the sense that they acquired a gene from a microorganism.”

(30.) This natural ability has made a genetically engineered version of the agrobacterium a favorite tool of molecular biology. See L. Herrera-Estrella, “Transfer and Expression of Foreign Genes in Plants,” Ph.D. thesis (Laboratory of Genetics, Gent University, Belgium, 1983); P. J. J. Hooykaas and R. A. Shilperoort, “Agrobacterium and Plant Genetic Engineering,” Plant Molecular Biology 19 (1992), 15–38; J. R. Zupan and P. C. Zambryski, “Transfer of T-DNA from Agrobacterium to the Plant Cell,” Plant Physiology 107 (1995): 1041–1047.